Tapestri Designer currently allows usage of predesigned amplicons to create a panel.
For each amplicon, following information should be present:
- Amplicon ID: This is the system generated ID. It is seen in the output files available in the results zip file.
- Chromosome Number: The chromosome number of the DNA amplicon or transcript number of the RNA amplicon.
- Amplicon Start: The start coordinate of the amplicon.
- Insert Start: The start coordinate of the insert region.
- Insert End: The end coordinate of the insert.
- Amplicon End: The end coordinate of the amplicon
- Genome: The genome ID that the amplicons belong to.
- Forward Primer: The forward primer sequence of the amplicon.
- Reverse Primer: The reverse primer sequence of the amplicon.
- Gene (RNA): The gene for the amplicon.
Examples:
MYE_v2_CSF3R_36932055 chr1 36932036 36932056 36932276 36932296 hg19 ACAGTCGTCCTCCTGGCTTG CAGACCTATGTGCTCCAGGG
MYE_v2_CSF3R_36932338,chr1,36932317,36932339,36932566,36932591,hg19,AGGTCTCTGAGCTGTTATGGGA,GGCATGTGTGAGGAACATACTAGTG- The amplicons can be tab separated or comma separated.
- Duplicate amplicons are not allowed.
- Two RNA amplicons for the same gene are not allowed
- Overlapping amplicons are not allowed.
- Amplicon length should be between 139 and 375 bp.
- Primer length should be between 18 and 35 bp.
- The amplicon coordinates should be one-based, fully closed. Otherwise, you may encounter an error "Primer sequences do not match with reference".
- We recommend using [panel-id]-design-summary.csv or the [panel-id]-designSummary.tab from a previously designed custom panel or catalog panel, to reuse the amplicons from those panels, and to avoid coordinates and formatting issues.
- Download DNA sample file template.
- Download RNA sample file template.