Tapestri Designer User Guide

  • Updated

Mission Bio’s Tapestri Designer is a web-based primer design tool that allows you to explore predesigned DNA panels or create custom ones that can be used in a multi-omics solution for simultaneous detection of single-nucleotide variants (SNVs), copy number variations (CNVs), and proteins from the same cell.

Key Features

  • Order inventoried or pre-designed catalog panels.
  • Create custom panels with targets and the genome of your choice. 
  • Copy amplicons from your custom panels or Mission Bio’s catalog panels to create a new panel with additional targets of your choice (merge capability).
  • Visualize amplicons for hg19, hg38 and mm10 genomes by uploading the custom tracks on the UCSC genome browser, for more details refer to this article.

Table of Contents

  1. Log In
  2. Settings Menu
  3. Create a Custom Panel
  4. Custom Panels Details
  5. Tapestri Designer Dashboard
  6. Catalog Panels
  7. Catalog Panel Details
  8. Output Files

Log In

To get the most out of Tapestri Designer, log into your Mission Bio account on Tapestri Portal. The functionality depends on several factors.

If you are not logged in, a new user, or have no custom designs:

When not logged into your Mission Bio account, you can only view the list of catalog panels and their target details. For any other action, such as downloading or copying a panel or creating custom panels, you must log into your account.

As a new user or someone without custom designs, Tapestri Designer’s home page displays options to browse our catalog panels and create a custom panel. 

Logged in with at least one custom panel:

When logged in and you have access to at least one custom panel, a dashboard displays at the bottom of the home page listing the panels.

Settings Menu

Click on your name in the top-right corner. A drop-down menu will appear.

SettingsMenu.png

Home
Click the Home menu item to navigate to the Designer home page.

Support
Click the Support menu item to go to the Support Center.

Logout
Click the Logout menu item, to log out of Tapestri Pipeline.

Create a Custom Panel

Important Terminology:

  1. Targets - User supplied chromosomal regions that are used to design new amplicons in a custom panel. 
  2. Predesigned Amplicons - User supplied amplicon sequences available outside of the Tapestri Designer which will be added to the new custom panel. These can be designed by Mission Bio’s white glove team or any other external primer design tool. 
  3. Panels - Tapestri Designer’s catalog or custom panels providing a set of targets and amplicons which will be added to the new custom panel.

The latest version of Designer offers a wide range of workflows to create a new custom panel. You can start with a new set of targets or reuse your existing Mission Bio designed panels or any other predesigned amplicons to create a new panel. Overall there are six possible workflows  to create a custom panel.

  1. New Targets Only
  2. Predesigned Amplicons Only
  3. Panels Only
  4. Targets + Predesigned Amplicons
  5. Targets + Panels
  6. Panels + Predesigned Amplicons
  • New Targets Only: Create a custom panel based on targets such as genes, regions, SNPs for hg19 genome and only region based targets for other genomes (for more information on different target types, refer to this article).
  •  Predesigned Amplicons Only : Create a panel using the  predesigned amplicons that are not available within the Tapestri Designer. Predesigned amplicons are defined as amplicons that were designed by either Mission Bio’s white glove team or any other external primer design tool. 
  • Panels only - Use this workflow to merge any panels - catalog or custom, available within the application.  
  • Targets + Predesigned Amplicons - Create a panel with predesigned amplicons from a previously designed panel outside of Tapestri Designer and add a new set of targets to those amplicons.
  • Targets + Panels - Use the Designer's catalog panels or custom panel and add a new set of targets to it. 
  • Panels + Predesigned Amplicons - Use the Designer's catalog panels or custom panels and add a set of predesigned amplicons.

 

On the home screen, click Create Panel.

CreatePanelButton.png

The custom panel creation screen will appear.

Step0.png

Name the Panel

  • Panel Name: Provide a name for the panel. It can be up to 100 characters, consisting of letters, numbers, special characters, and spaces.
  • Description: Enter an optional description for the panel. It can be up to 250 characters, consisting of letters, numbers, special characters, and spaces.
  • Click Next.

Step 01 – Select Parameters

  • Assay Type: Preset. Currently, Tapestri Designer supports only the DNA assay.
  • Amplicon Length Range: The amplicon length range is preset to 190 – 270 bp.
  • Genome: Select the genome of choice from the drop-down menu. Tapestri Designer provides catalog human genome hg19 (GRCh37), hg38 (GRCh38) and mouse genome mm10 (GRCm38). Additionally, you may upload your own by following the steps provided here. Any previously uploaded genomes will be listed in the menu.
  • Click Next.

Step 02 – Provide Panel Inputs

Enter the targets, custom amplicons, or panel information to create a panel. 

Important Note: You can use a combination of up to two categories, i.e, you can either provide one of targets or custom amplicons or panels as input or a combination of two at a time like targets + custom amplicons or targets + panels or custom amplicons + panels. All three inputs cannot be provided together at once.

Input 1 - Targets

Enter the targets for the custom panel by uploading a .csv. Alternatively, paste or type the target information.

Important: The .csv must use a comma (,) as the separator. The EU semicolon separator (;) will not work. A sample template file can be found here.

  • Upload File: To upload a file, drag and drop it into the box. Or click Choose File to locate the file. If the .csv file has a header row and the File has a header (skips the first line) checkbox is not checked then click it to ignore that information. The file should have two columns with an optional third – Type, ID, and Name (optional).
  • Add Targets: Click Add Targets to paste or manually enter the targets. If the pasted targets have a header row and the File has a header (skips the first line) checkbox is not checked then click it to ignore that information. 

Target Formats

Targets must be in this format: target type, target ID, and target name (optional). 

Example Tapestri Designer input

gene, TP53, p52_mutation

region, chr10:106721610-106721610, variant-ABC

dbSNP, rs4880, SOD2_mutation

hgvs, PIK3CA:C.1633G>A, PIK3CA

Notes 

  • The spaces after the commas are optional. 
  • Only the hg19 catalog genome supports all targets. Please use ‘region’ targets for all other genomes.
  • Gene names are not case-sensitive.
  • Duplicate target IDs and names are not allowed.
  • Commas are field separators and cannot be used in target names.
  • Target names can contain numbers, letters, “-” and underscore only.

For more information about target types and a sample .csv file, refer to Target types.

 

Input 2 - Predesigned Amplicons

Enter the amplicons for the custom panel by uploading a Design summary file (.csv or .tab). Alternatively, paste or type the amplicon information.

Important: The .csv or .tab must use a comma (,) or tab as the separator respectively. The EU semicolon separator (;) will not work. A sample template file can be found here.

  • Upload File: To upload a file containing amplicons, drag and drop it into the box. Or click Choose File to locate the file. If the .csv or .tab file has a header row and the File has a header (skips the first line) checkbox is not checked then click it to ignore that information. The file should have nine columns – amplicon ID, chromosome number, amplicon start, insert start, insert end, amplicon end, reference genome, forward primer sequence, reverse primer sequence. Any additional columns will be ignored at the time of upload.
  • Add Amplicons: Click Add Amplicons to paste or manually enter the amplicons. If the pasted amplicons have a header row and the File has a header (skips the first line) checkbox is not checked then click it to ignore that information.

Amplicon Format

Amplicons must be in this format: amplicon ID, chromosome number, amplicon start, insert start, insert end, amplicon end, reference genome, forward primer sequence, reverse primer sequence.

Example Tapestri Designer input

MYE_v2_CSF3R_36932055	chr1	36932036	36932056	36932276	36932296	hg19	ACAGTCGTCCTCCTGGCTTG	CAGACCTATGTGCTCCAGGG

MYE_v2_CSF3R_36932338 chr1 36932317 36932339 36932566 36932591 hg19 AGGTCTCTGAGCTGTTATGGGA GGCATGTGTGAGGAACATACTAGTG

Notes

  • The amplicons can be tab separated as per the example above or comma separated. Commas should be used as separators when typing the data in the text box as pressing tab key will move the cursor out of the text box.
  • Duplicate amplicons are not allowed.
  • We recommend using [panel-id]-design-summary.csv or the [panel-id]-designSummary.tab from a previously designed custom panel or catalog panel, to reuse the amplicons from those panels and avoid formatting issues.

For more information about amplicon format and a sample .csv or .tab file, refer to Amplicon Format.

 

Input 3 - Panels

Select the panels to be merged in the new custom panel and define the conflict resolution mode, i.e., how to address the overlapping amplicons if more than one panel is imported.

  • Select Existing: To select the panels click Select Existing. This opens a new window which lists the Catalog as well as Custom panel based on the genome that was selected in the previous step. Select as many panels as you want, but the panel order cannot be placed in Designer if the total amplicon count for the selected panels exceeds 1000.

Important Note: In case of other inputs like targets or amplicons along with the panels, consider the number of amplicons that these inputs will fetch and adjust the selected panels accordingly.

  • Define Conflict Resolution Mode: Tapestri Designer provides two options for resolving possible amplicon conflicts or overlaps - Automatic and Manual. In order to resolve conflicts automatically, please check the Resolve Conflicts Automatically checkbox, it is checked by default. Priority for conflict resolution is assigned by the order of the panel in the table. For example, amplicons from a priority 1 panel will be chosen over amplicons from a priority 2 panel in case of a conflict. Manual resolution will be chosen if the checkbox is unchecked and requires the user to address all amplicon issues in the next step. More details on reviewing and resolving the amplicon conflicts is provided in the next section.
  • Remove Panels: Remove selected panels by clicking the ‘X’ in front of the row or delete all panels by clicking the Clear button.

NOTE: If both amplicons and panel input are provided then automatic conflict resolution is disabled as there can be conflicts between the user provided amplicons and the amplicons imported from the panels and the system does not know which ones to retain.

Once all the inputs are provided click Next.

NOTE: If the Next button is disabled, click outside the text boxes to enable it.

Step 03 – Review Panel Contents

After entering the target information, the targets will be preprocessed to resolve them to chromosomal regions. The status of your panel will be Preprocessing.

  • Click the Refresh icon to see the latest results.

The pre-processing involves the following based on the input type:

  1. Targets - User provided targets are resolved into chromosomal coordinates. This is relevant for the hg19 genome where users can provide Gene, SNPs or HGVS IDs as targets. The chromosomal coordinates are then validated to check that they belong to the selected genome and can be used for panel design.
  2. Amplicons - The given amplicon information, like the amplicon and insert coordinates, primer sequences etc., are validated with respect to the selected genome.
  3. Panels - For each input panel, the targets and amplicons are imported and conflicts are identified. Conflicts arise when two or more panels are imported with duplicate targets or overlapping amplicons.
    1. Targets conflict resolution - Exact same targets are merged together and only one copy is retained. When targets overlap only partially then both the targets are retained.
    2. Amplicon conflict resolution - Amplicon conflicts are important to resolve as Tapestri does not support overlapping amplicons. Similar to targets, only a single copy of the amplicon is imported if it is present across multiple panels. The amplicon row in the table will list the name of all the panels to which it belongs. Conflicting amplicons have to be resolved in the subsequent steps.

Once the inputs have been preprocessed, the panel status will change to Draft.

Target Review

Review the targets in the targets table and if the panel contains any targets with errors, those need to be edited or removed to proceed further. The targets table supports the following actions:

 

  • To edit a target, such as the type, name, or ID, click the edit icon next to the target. Click the green checkmark to accept the change, or the red “x” to revert the change.
  • To delete a target, click the trashcan icon, and click Yes, Delete in the Delete Target(s) pop-up.
  • Add Target: To add more targets, click Add Target.
    In the pop-up screen, select the Target Type, enter Target ID and an optional Target Name. Repeat this process for any additional targets you want to add.
    AddTargetModal.png
  • Search: Type in either a type, name, or ID to display a list of only those targets.
  • Bulk Actions: Click the checkbox to the left of each target to enable the bulk actions menu.
  • Sort: Sort the targets by any column in ascending or descending order by clicking the header name.

NOTE: Targets imported from panels or generated from amplicons cannot be edited or deleted, hence the edit/delete icons are missing for those targets.

Possible Target Errors

Invalid ID: The format of the ID is invalid. Change the ID to match the required format.

Duplicate Target: Neither duplicate target ID nor Names are allowed. Edit or delete the target.

Invalid Region Target: Region targets are validated to check the chromosome length constraint. Regions with either start or stop values greater than the chromosome length are marked invalid.

Incorrect Target ID Format: If the target ID contains an additional space, it is marked invalid. For example, Chr13: 28674559-28674790 is invalid.

Incorrect Target ID or Name: Target IDs and names cannot contain commas. When added, they are removed from the targets before creating the panel.

Masked Regions: If the target has many masked regions (Ns in reference .fasta for the target), the panel will fail. Avoid adding region targets with these.
Step03-AddTargetButton.png

 

Amplicon Review

To view the amplicons in your panel, click the Amplicons tab. As with targets, all amplicon errors must be resolved before proceeding.

  • To edit an amplicon, such as the name, chromosome number, coordinates or primer sequences, click the edit icon next to the amplicon. Click the green check mark to accept the change, or the red “x” to revert the change.
  • To delete an amplicon, click the trashcan icon, and click Yes, Delete in the Delete Amplicon(s) pop-up.
  • Search: Type in either a name, chromosome number, coordinate or primer sequence to display a list of only those amplicons.
  • Bulk Actions: 
    • Delete multiple amplicons: Click the checkbox to the left of at least one amplicon to enable the bulk actions menu. From the bulk actions select the Delete option. It is important to note that if both the amplicons of a conflicting pair are selected then both will be deleted.
    • Delete multiple amplicons by Panel: To delete multiple amplicons from a panel, select amplicons and choose the Delete by Panel option. Select the panel from which the amplicons need to be deleted and click Confirm. To delete the user supplied amplicons select Other.
  • Sort: Sort the amplicons by any column in ascending or descending order by clicking the header name.

NOTE: Amplicons imported from panels cannot be edited, hence the edit icon is missing for those amplicons.

Possible Errors

Invalid chromosome: The chromosome does not match the reference genome.

Duplicate Amplicon: Duplicate Names, amplicon and insert coordinates, and sequences are not allowed. Edit or delete the amplicon.

Invalid Insert or Amplicon Coordinate: Amplicon and insert coordinates are validated to check the chromosome length constraint. Coordinates with either start or stop values greater than the chromosome length are marked invalid.

Incorrect Amplicon: If the amplicon start is greater than amplicon end or insert start, it is marked invalid. If the amplicon falls beyond the amplicon length constraint, it is invalid.

Incorrect Primer: If the primer sequence falls beyond the primer sequence length constraint, it is invalid. If the primer sequence does not match the reference, it is invalid.

Overlapping Amplicons: If the amplicons overlap with each other, those are flagged as erroneous.

 

 

Once all target and amplicon errors are resolved click Submit to submit your panel for processing.

In Progress

Once you submit your custom panel, the Panels Details page will display with a status of In Progress. It will also display in the dashboard on the Tapestri Designer home page as In Progress. You will receive an email confirming that you submitted a panel for processing.

During the processing, amplicons are generated to cover the targets, and the coverage percentage is calculated. In-silico quality checks will be run on the generated primers/amplicons and the details provided on the panel details page for custom panels. When the design is complete, you will receive another email.

Note: After submitting the panel for processing, no further editing is possible. To include more targets, click on the three vertical dots in the Custom Panels dashboard next to the Panel name. Select Copy Targets. This will create a new custom panel where you can add more targets. Only the targets are copied, not the amplicons.

ContextMenu.png

Ready

When the processing is complete, you will receive notification that the results are ready via an email, which includes the panel details. The status in the dashboard will change to Ready.

Download the files created by Designer during processing to view the details or use as input into Tapestri Pipeline.

If the panel details page is still open when you receive the email, click the Refresh button to update the information.

NOTE: For any new panel if you see that the panel is ready but QC status is Not Available then reload the page after the design completion email is received. QC checks are run after the amplicons are designed and take a couple of minutes to an hour to run based on panel size. If you visit the page after receiving the email then the QC status should be either complete or failed and data available in the Amplicons table.

Custom Panels Details

Click on a custom panel name from the Custom Panels Dashboard to open the Panel Details page. Opening a custom panel details page may show a QC warning, refer to this article for more details.

The custom panel details are presented in two sections. The top section displays the panel details, and the bottom section displays the target and amplicons details. 

Top section – Panel details

The top section of the panel details page presents the panel details.

  • Status: Each panel has 2 status listed at the top - Panel Status and QC Status
    • Panel status
      • In progress
      • Ready 
      • Failed
    • QC status 
      • Not Available - Status for all old panels(before 12/18/2024) that do not have the QC results. Any new panel for which QC is in progress.
      • Complete: QC is complete and results are available.
      • Failed: QC failed to complete.
  • Panel Name: The name of the panel provided during panel creation.
  • Description: The description of the panel provided during panel creation.
  • Source Panel: Parent panel for panels created using Delete and Save Option.
  • Coverage: The percentage of the target base pairs covered by the insert regions. It is the in-silico R1R2 coverage value of the panel calculated using 150 bp as the read length for paired-end sequencing. If the panel was created using predesigned amplicons, the coverage percentage reflects the coverage of all the targets not including the regions covered by the overlapping amplicons.
  • # Targets: The number of targets in the panel. Details about these targets display in the bottom table of the page. Each target is a separate line in the list.
  • Target Size: The target size is the total number of DNA base pairs covered by all the targets in the panel.
  • Panel Size: The panel size is the total number of DNA base pairs covered by all the inserts in the panel.
  • Amplicon Length Range: The amplicon length range is preset to 175 - 275 bp.
  • # Amplicons: The sum of all the amplicons generated to create the best possible coverage of all the targets.
  • Validated: No for custom panels because these are not experimentally validated.
  • Assay Type: Currently, Tapestri Designer only supports DNA.
  • Genome: Tapestri Designer provides human genome hg19 (GRCh37), hg38 (GRCh38) and mouse genome mm10 (GRCm38). Additionally, you may upload your own by following the steps in this document.
  • Warning: Some panels contain amplicons that may have failed one of the QC checks. In this case, a warning displays at the top of the page, and the impacted targets display a yellow triangle to the left of the target ID.
  • More Actions: Click More Actions to access additional features:
    MoreActions.png
    • Download Results: Click the Download Results button to download a .zip file that contains the output files exported from Tapestri Designer.
      For more information on these files, refer to this section.
    • Copy Targets: Click the Copy Targets button to create a new custom panel based on the current panel. Only the targets are copied, not the amplicons.
      For more information about creating custom panels, refer to Create a custom panel.
    • Share: Click the Share button to share the custom panel with other users. The Share screen will appear.
      ShareModal.png
      • In the Email field, add the email IDs of other users who have an account on Tapestri Portal, separated by either a comma (,) or semicolon (;). 
      • Add personal Notes up to 10,000 characters, and click Save.
        This sends an email to the recipients’ email IDs. Those users can then access the shared panel after logging into Mission Bio Portal. Once you share a panel, you can never delete it. The people you share it with can delete it, however.
      Note: Panels can only be shared with existing users who have an account on Mission Bio Tapestri Portal and have opened Tapestri Designer. Once those two conditions are met, panels can be shared with them.
    • Delete: Click the Delete button to permanently delete the custom panel. If a panel has been ordered or shared, it cannot be deleted.
  • Request Quote: Click Request Quote to send a message to Mission Bio. Someone from our team will contact you soon. Sales are completed offline.
    RQ.png
  • Delete and Save: This option is only seen when a few amplicons are selected on the Amplicons tab. Click this to delete the selected amplicons from the panel and create a new panel with the remaining. For more details on this functionality refer to this article.

Bottom Section – Details

The bottom section of the Panel Details page shows the details of the targets and amplicons.

Targets

  • Search: Type in a target name or ID to quickly locate that target.
  • Each target is listed with the following information:
    • Type
      • Gene: Official HGNC gene name. Applies only to catalog genome hg19 (GRCh37).
      • Region: Chromosome coordinates from the selected genome assembly.
      • dbSNP: dbSNP ID. Applies to only catalog genome hg19 (GRCh37).
      • HGVS: HGVS nomenclature supported by VarSome. Applies only to catalog genome hg19 (GRCh37).
    • Target ID: The ID is based on the target type.
    • Target Name: This optional field is a text identifier for the target to make it understandable to the user. Each name should be a unique identifier within a panel.
    • # Amplicons: The number of amplicons for the target.
    • % Coverage: The insert coverage of the target. 
  • Sort: Sort the targets by any column, except the UCSC Browser, in ascending or descending order by clicking the header name.

Amplicons

  • Search: Type in amplicon name, ID or insert/amplicon start or end coordinate to quickly locate that amplicon.

  • Each amplicon is listed with the following information:

    • Amplicon Name: The amplicon name provided at the time of panel creation for pre-designed amplicons. Or it is the same as the Amplicon ID if no pre-designed amplicons were provided during panel creation.
    • Amplicon ID: This is the system generated ID. It is seen in the output files available in the results zip file.
    • Target ID(s): List of targets covered by an amplicon. This column only displays the targets for the newly designed amplicons. Targets covered by the pre-designed amplicons are not displayed for now. Thus, a blank Target ID for pre-designed amplicon does not mean that there are no targets covered by this amplicon, it means that the information is not available.
    • # QC Warning(s): Count of QC warnings, can be used to sort the table to see the amplicons with issues at the top.
    • QC Warning(s): QC warnings raised for the given amplicon, there are 9 possible warning:
      • High GC Amplicon
      • Mispriming
      • Insert-Genome Alignments
      • Primer Homodimers
      • Primer Heterodimers
      • Forward Primer-Genome Alignments
      • Reverse Primer-Genome Alignments
      • Forward Primer-Amplicon Alignments
      • Reverse Primer-Amplicon Alignments

For more details about each individual check refer to this article.

    • Source Panel: In case the amplicons are imported from another panel the source panel name is listed in the table and clicking it opens the panel in a new tab.
    • Chromosome Number: The chromosome number of the amplicon.
    • Amplicon Start: The start coordinate of the amplicon.
    • Insert Start: The start coordinate of the insert region.
    • Insert End: The end coordinate of the insert.
    • Amplicon End: The end coordinate of the amplicon.
    • Genome: The genome ID that the amplicons belong to.
    • Forward Primer: The forward primer sequence of the amplicon.
    • Reverse Primer: The reverse primer sequence of the amplicon.
  • Sort: Sort the amplicons by any column, except the QC Warning(s), Target ID(s), UCSC Browser and Genome, in ascending or descending order by clicking the header name.

Tapestri Designer Dashboard

The dashboard has two tabs. The Custom Panels tab lists each custom panel. The Custom Genomes tab lists each custom genome uploaded to your account. 

Custom Panels

The dashboard lists the following information for each custom panel.

CustomPanels.png

  • Panel Name: The panel name has a maximum length of 100 characters and can contain spaces, numbers, and symbols. Clicking on a panel name that is in Draft mode opens the panel creation workflow. Clicking on a panel name that is in In Progress, Ready, or Failed opens the Panel Details page, which displays all the information about it.
  • ID: The panel ID is a unique number and automatically generated. This number cannot be changed.
  • Genome: The genome name used to create the custom panel. Tapestri Designer provides catalog human genome hg19 (GRCh37), hg38 (GRCh38) and mouse genome mm10 (GRCm38). Additionally, you may upload your own by following these steps. All coordinates in the panel should belong to the selected genome assembly.
  • # Targets: The total number of targets in the panel.
  • # Amplicons: The number of amplicons is displayed for panels that have a status of Ready. It is calculated when you submit the panel for processing. In case the panel was created with predesigned amplicons, the total number of amplicons will be displayed.
  • % Coverage: The coverage percentage is displayed for panels with a status of Ready. It is calculated when you submit the panel for processing. It is the percentage of the target base pairs covered by the insert regions(including the predesigned amplicons if used). It is the in-silico R1R2 coverage value of the panel calculated using 150 bp as the read length for paired-end sequencing. 
  • Last Updated: The date of the last edit to the panel.
  • Created By: The email address of the owner who created the panel.
  • Status: The current status of the panel. 
    • Preprocessing: The targets in the panel are being resolved to chromosomal regions.
    • Draft: The panel has not been submitted for processing. The panel can be edited to add, edit, and delete targets.
    • In Progress: The panel was submitted for processing, and Mission Bio is working on generating the amplicons and coverage percentage. The panel can no longer be edited. You will receive an email when processing is complete.
    • Ready: The process is complete. The amplicons were generated, and the coverage calculated. The panel can be viewed, copied, and shared but not edited. You can also Download Results. These options are available by clicking on the three vertical dots next to the Panel Name.
    • Failed: No amplicons were generated, so the panel is not valid.
  • Search: To search for specific panels, type the criteria into the search box. You can search for:
    • Panel Name
    • ID
    • Genome
    • # Targets
    • # Amplicons
    • % Coverage
    • Status
  • Refresh Icon: Click the Refresh icon to update the status of custom panels.
    RefreshIcon.png
  • Sort: Sort the panels by any of the columns in ascending or descending order by clicking the header name.

Custom Genomes

To access information on the catalog genomes and custom genomes you uploaded, click the Custom Genomes tab.

CustomGenomes.png

The dashboard lists the following information for each genome:

  • File Name: The file name of the genome .fasta file provided at the time of upload.
  • BED File Name: The polymorphism .bed file name provided at the time of upload.
  • Genome Name: The genome name provided at the time of upload.
  • Status: The status of the file upload. 
  • Uploaded Date: The date of the file upload. 
  • Genome Size: The size of the genome post processing. 
  • Uploaded By: The email account used to upload the file.
  • Common Name: The common name provided at the time of upload.
  • Scientific Name: The scientific name provided at the time of upload.
  • Assembly Version: The assembly version provided at the time of upload.
  • # Contigs: The total number of contigs provided at the time of upload.
  • Search: To search for specific files, type the criteria into the search box. You can search for:
    • File Name
    • BED File Name
    • Genome Name
    • Status
    • Uploaded By
    • Common Name
    • Scientific Name
    • Assembly Version
    • Contigs
  • Refresh Icon: Click the Refresh icon to update the status of custom genome uploads.
  • Sort: Sort the genomes by any of the columns in ascending or descending order by clicking the header name.

Upload Genome

To upload a custom reference file, click the Upload Genome button.

The Custom Genomes screen will appear. Fill in the details in the input fields. 

UploadCustomGenome.png

  1. Genome Name: Must be between 3 and 50 characters, consisting of letters, numbers, and supported special characters: hyphen (-) and underscore (_). 
  2. *Common Name: The common name of the organism the sequences belong to. Must be between 3 and 50 characters, consisting of letters and numbers.
  3. *Scientific Name: The scientific name of the organism the sequences belong to. Must be between 3 and 100 characters, consisting of letters and numbers.
  4. *Assembly Version: The genome version of the custom reference file must be between 1 and 20 characters, consisting of letters and numbers.
  5. *# Contigs: Total number of contigs in the file.
  6. Genome FASTA file: Select the custom reference .fa file. For file specifications, please refer to this document.
  7. Polymorphism loci on primers BED file (optional): Select a polymorphism .bed file containing the regions of high polymorphism. For file specifications, please refer to this document.

*While these fields are mandatory they are only displayed in the genomes table and not used anywhere else in the application

To save your custom reference file, click Submit. This starts the uploading process. The file will be added to the table of Custom Genomes with a status of Processing. The upload time varies based on the reference file size. Once the file completes uploading, the status of the custom reference file will change to Completed. 

This reference file will now be available for use when creating custom panels in Step 01 - Select Parameters. The drop-down menu for Genome selection will list the file with the Genome name provided.

Note: Once the files have been uploaded, no changes can be made. If you need to make changes, upload the edited files using the Upload Genome button.

Catalog Panels

Clicking the View Panels button from the Tapestri Designer home page takes you to the Catalog Panels page where you can explore the current catalog panel designs.

CatalogPanelsDashboard.png

The pre-selected tab lists the DNA catalog panels. 

The top four panels are experimentally verified and Ready-to-Ship. These are followed by the predesigned targeted panels that are Built-to-Order. These panels have not been verified in a lab. 

Click the Protein tab to access catalog protein panels.

Catalog Panels Dashboard

The dashboard lists the following information for each catalog panel:

  • Panel Name: The name of the panel. 
  • Panel Type: The type of the panel, whether the panel is Ready-to-Ship or Built-to-Order.
  • Genome: The genome of the panel.
  • # Targets (DNA only): The number of targets in the panel.
  • # Amplicons (DNA only): The number of amplicons covering the targets.
  • % Coverage (DNA only): This number describes how well the amplicons cover the targets.
  • # Antibodies (Protein only): The number of antibodies in the protein catalog panel.
  • Validated: True for panels that have been validated in a lab. False for panels that have not been validated.
  • Last Updated: The date of the last edit to the panel.

Navigation

  • Search: To search for specific panels, type the criteria into the search box. You can search for:
    • Panel Name
    • Panel Type 
    • Genome
    • # Targets
    • # Amplicons
    • % Coverage
    • Validated
  • Details: Click the panel name to open the catalog panel details page and view additional information.
  • Sort: Sort the panels by any of the columns in ascending or descending order by clicking the header name.
  • Download Results: Click on the three vertical dots next to the Panel name to download the results.
  • Copy Targets (DNA only): Click on the three vertical dots next to the Panel name to copy the targets and start designing a new custom panel. Only the targets are copied, not the amplicons.

Catalog Panel Details

Click on a catalog panel to open the Panel Details page. The details are presented in two sections. The top section displays the panel details, and the bottom section displays the target details. 

CatalogPanelDetails.png

Top Section – Panel Details

The top section of the panel details page displays the panel level information:

  • Panel Name: The name of the panel.
  • Description: A description of the panel.
  • Coverage (DNA only): The percentage of the target base pairs covered by the insert regions. It is the in-silico R1R2 coverage value of the panel calculated using 150 bp as the read length for paired-end sequencing.
  • # Targets (DNA only): The number of targets in the panel. Details about these targets display on the bottom of the page. Each target is a separate line in the list.
  • Target Size (DNA only): The target size is the total number of DNA base pairs covered by all the targets in the panel.
  • Panel Size (DNA only): The panel size is the total number of DNA base pairs covered by all the inserts in the panel.
  • Amplicon Length Range (DNA only): The amplicon length range is preset to 175 – 275 bp.
  • # Amplicons (DNA only): The sum of all the amplicons generated to create the best possible coverage of all the targets.
  • # Antibodies (Protein only): The number of antibodies in the protein catalog panel.
  • Validated: True for panels that have been validated in a lab. False for panels that have not been experimentally validated.
  • Assay Type: Assay type DNA or Protein.
  • Genome: Tapestri Designer provides catalog human genome hg19 (GRCh37), hg38 (GRCh38) and mouse genome mm10 (GRCm38). 
  • Warning (DNA only): Some panels contain amplicons that are positioned in high GC regions. In this case, a warning displays at the top of the page, and the impacted targets display a yellow triangle to the left of the target ID.
  • More Actions: Click More Actions to access the following:
    MoreActions-Catalog.png
    • Download Results: Click the Download Results button to download a .zip file that contains the output files exported from Tapestri Designer.
    • Download Datasheet (DNA only): Click the Download Datasheet button to download a .pdf file that contains detailed information about the panel, including the panel specifications and targets. This is only available for the following catalog panels – Tumor Hotspot, Myeloid, Chronic Lymphocytic Leukemia, Acute Myeloid Leukemia, Chronic Myeloid Leukemia, Diffuse Large B Cell Lymphoma, T-Cell Lymphoma, Acute Lymphoblastic Leukemia, Myelodysplastic Syndromes, Myeloproliferative Neoplasms, Classic Hodgkin's Lymphoma, Multiple Myeloma, Mantle Cell Lymphoma, and Follicular Lymphoma.
      For more information on these files, refer to this section.
    • Copy Targets (DNA only): Click the Copy Targets button to create a new custom panel based on the current panel. Only the targets are copied, not the amplicons.
      For more information about creating custom panels, refer to Create a custom panel.
  • Request Quote: Click Request Quote to send a message to Mission Bio. Someone from our team will contact you soon. Sales are completed offline.
    RQ.png

Bottom Section – Details (DNA)

The bottom section of the Panel Details page shows the details of the targets.

  • Search: Type in a target name or ID to quickly locate that target.
  • Sort: Sort the targets by any of the columns, except UCSC Browser, in ascending or descending order by clicking the header name.

Each target is listed with the following information:

  • Type: The options are:
    • Gene: Official HGNC gene name
    • Region: Chromosome coordinates from the hg19 genome assembly
    • dbSNP: dbSNP ID
    • HGVS: HGVS nomenclature supported by VarSome
  • Target ID: The ID is based on the target type.
  • Target Name: This optional field is a text identifier for the target to make it understandable to the user. Each name should be a unique identifier within a panel.
  • # Amplicons: The number of amplicons for the target.
  • % Coverage: The percentage of the target base pairs covered by the insert region. It is the in-silico R1R2 coverage value calculated using 150 bp as the read length for paired-end sequencing.

Bottom Section – Details (Protein)

The bottom section of the Panel Details page shows the details of the targets.

  • Search: Type in a protein name, clone name, clone description, or barcode sequence to quickly locate the protein.
  • Sort: Sort the targets by any of the columns in ascending or descending order by clicking the header name.

Each target is listed with the following information:

  • Protein Name: Antibody name.
  • Clone Name: Clone name.
  • Clone Description: Short description for the protein antibodies.
  • Barcode Sequence: 15 bp oligo sequence to identify the antibodies.

Output Files

Tapestri Designer generates 10 files that are downloaded as a .zip file for custom DNA panel files. This .zip file should be submitted to the Tapestri Pipeline without any changes.

The 4 files at the top level are used to run Tapestri Pipeline.

  1. [panel-id].amplicons
    This file contains the list of amplicons designed for the submitted targets. For more information, see this file.
  2. [panel-id].bed
    This file contains genomic coordinates for the insert regions of interest. For more information, see this file.
  3. [panel-id].gatk
    This file contains genomic coordinates for the targets that get used in downstream processing in Tapestri Pipeline. For more information, see this file.
  4. systemic-variants.blacklist
    The systemic-variants.blacklist file lists the genomic regions for suspected false-positive variants. The blacklisted variant’s coordinates are used to remove such variants from the final output files.
    The Designer folder in the .zip file contains 6 panel files in human-readable format, which are .bed and .csv files.
  5. [panel-id]-amplicon.bed
    This file lists the coordinates for the amplicons that cover the given input targets. For more information, see this article.
  6. [panel-id]-coverage-summary.csv
    This file contains the coverage information for the given input targets. For more information, see this article.
  7. [panel-id]-design-summary.csv
    This file contains information about the input targets and the corresponding amplicons. For more information, see this article.
  8. [panel-id]-insert.bed
    This file contains the genomic targets for the given input targets. For more information, see this article.
  9. [panel-id]-missed.bed
    This file lists the genomic coordinates for the targets that are not covered or are missed by the amplicons. For more information, see this article.
  10. [panel-id]-submitted.bed
    This file contains information on the user-defined targets that are converted to coordinates. For more information, see this article.
  11. [panel-id]-qc-summary.csv
    This file contains information about the QC checks for each amplicon. For more information, see this article
  12. Dropped_amplicons.csv
    This file lists the amplicons that were dropped during conflict resolution during custom panel creation or the amplicons that were removed from a results ready panel to create a new panel. For more information, see this article
Share this article:

Was this article helpful?

1 out of 1 found this helpful

Have more questions? Submit a request