How do I convert a DNA design summary file from hg19 to hg38?

Tapestri Designer catalog panels are designed on the human genome hg19 (GRCh37). Some Designer workflows, such as designing RNA panels, need the panel's design summary file in hg38 (GRCh38) coordinates. This article walks you through converting a panel's design summary file from hg19 to hg38 with the free UCSC LiftOver tool, using the Myeloid catalog panel (312 amplicons) as an example.

Table of Contents

1. Step 01 – Download the Design Results
2. Step 02 – Convert the Amplicon Coordinates
3. Step 03 – Convert the Insert Coordinates
4. Step 04 – Build the hg38 Design Summary
5. Step 05 – Quality Control Checks
6. Troubleshooting

Step 01 – Download the Design Results

1. Navigate to Tapestri Designer and log into your Mission Bio account.
2. Open the panel. For a catalog panel, click View Panels and click the panel name (for example, Myeloid). For a custom panel, click the panel name in the Custom Panels dashboard.
3. Click More Actions. A drop-down menu will appear.
4. Click Download Results. A .zip file will download.

5. Unzip the file.

   

The [panel-id]-design-summary.csv file lists each amplicon in the panel with the following information:

• AmpID: The amplicon ID.
• chr: The chromosome of the amplicon.
• amplicon_start, amplicon_end: The start and end coordinates of the amplicon, including the primers.
• insert_start, insert_end: The start and end coordinates of the insert region.
• Ref_Genome: The genome the coordinates belong to (hg19).
• fwd_seq, rev_seq: The forward and reverse primer sequences.
• Targets: The targets covered by the amplicon.

You will use three files from the .zip file. The two files at the top level are already in a format LiftOver accepts:

Important Note: The two top-level files use different start coordinates. Keep track of which file is which, because the corrections in Step 04 differ for each file.

Step 02 – Convert the Amplicon Coordinates

Navigate to UCSC LiftOver. Set the original genome first, as the page may open on a different species.

1. In Change original genome, type hg19.
2. Select Human (hg19) from the drop-down list.

Confirm the settings and enter the amplicon coordinates. The numbers below match the screenshot.

1. Currently selected genome: Human (hg19).
2. Change new genome: Human. Change new assembly: Dec. 2013 (GRCh38/hg38).
3. Minimum ratio of bases that must remap: 0.95 (default). Leave all other settings at their defaults.
4. Open [panel-id].amplicons in a text editor, copy all lines, and paste them into the text box.
5. Click Submit.
6. Alternatively, click Choose File, select [panel-id].amplicons, and click Submit file.

When the conversion is complete, the Results section displays the number of converted records. For the Myeloid panel, all 312 amplicons converted.

7. Click Download conversions and rename the file to amplicons_hg38.bed.

NOTE: LiftOver treats the start coordinate as 0-based even though [panel-id].amplicons is 1-based. This is expected. Every position shifts by the same amount, so the converted start is still 1-based and needs no correction in Step 04.

Step 03 – Convert the Insert Coordinates

Repeat Step 02 with the insert file. The settings stay the same.

1. Click Clear to empty the text box.
2. Paste the contents of [panel-id].bed into the text box, or upload it with Choose File and Submit file.
3. Click Submit.
4. Confirm the number of converted records matches the number of amplicons. For the Myeloid panel, all 312 inserts converted.
5. Click Download conversions and rename the file to inserts_hg38.bed.

Each converted file has the same four columns as the original plus a fifth column, which can be ignored. For example, the first Myeloid amplicon:

For large panels or many panels, UCSC also offers a command-line LiftOver tool with the hg19ToHg38 chain file.

Step 04 – Build the hg38 Design Summary

Match each converted amplicon and insert back to the original design summary by AmpID, and apply the corrections below. All other columns stay the same.

For the first Myeloid amplicon, the hg38 row reads:

AmpID,chr,amplicon_start,insert_start,insert_end,amplicon_end,Ref_Genome,fwd_seq,rev_seq,Targets
MYE_v2_CSF3R_36932055,chr1,36466435,36466455,36466675,36466695,hg38,ACAGTCGTCCTCCTGGCTTG,CAGACCTATGTGCTCCAGGG,CSF3R:p.S810Qfs*6; ...

NOTE: Keep the AmpID unchanged. It contains the hg19 position, but it is the key that links the two builds.

1. Open [panel-id]-design-summary.csv in Excel.
2. Open amplicons_hg38.bed and inserts_hg38.bed in Excel, and copy each into a new sheet of the design summary workbook. Name the sheets amp and ins.
3. Select both rows of the table below, copy them, click cell L1 on the design summary sheet, and paste. The headings fill row 1 and the formulas fill row 2 of columns L to P.

4. Fill the formulas down to the last amplicon. A #N/A means that amplicon failed to convert.
5. Copy columns L to P and use Paste Special > Values over columns B to F.
6. Replace hg19 with hg38 in the Ref_Genome column, then delete columns L to P.
7. Click File > Save As, choose CSV (Comma delimited), and name the file [panel-id]-design-summary_hg38.csv. Save only the design summary sheet.

Step 05 – Quality Control Checks

Before using the hg38 design summary, confirm each amplicon converted cleanly:

• No #N/A values: every AmpID converted in both files.
• Same chromosome: the chr column matches the original design summary.
• Same lengths: amplicon length (amplicon_end − amplicon_start) and insert length (insert_end − insert_start) are unchanged from hg19.

For the Myeloid panel, all 312 amplicons pass all three checks.

Reference Sequence Differences

A small number of bases differ between the hg19 and hg38 reference sequences, so an amplicon can convert correctly and still cover a changed base. In the Myeloid panel, one such base (chr20:32,435,156, T in hg19 and C in hg38) falls in the primers of MYE_v2_ASXL1_31022711 and MYE_v2_ASXL1_31022977.

Important Note: Tapestri Designer checks that predesigned primer sequences match the reference genome. Amplicons with a changed base in a primer may be flagged with an Incorrect Primer error when the hg38 design summary is used as a Predesigned Amplicons input. Contact support@missionbio.com if this occurs.

Troubleshooting

Some regions fail to convert

The region may be deleted, split or partially deleted in hg38.

How to address: Review the failure file linked in the Results section. If only the amplicon or only the insert converts, treat the amplicon as failed. Do not convert the primers on their own to rescue these amplicons. Contact support@missionbio.com with the affected AmpIDs.